Mature sequence ptr-miR-184

Accession numberMIMAT0002301
IDptr-miR-184
Stem-Loop ptr-mir-184
Sequence
uggacggagaacugauaagggu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).