Mature sequence mml-miR-181a-5p

Accession numberMIMAT0002506
IDmml-miR-181a-5p
Previous IDsmml-miR-181a
Stem-Loop mml-mir-181a-2 mml-mir-181a-1
Sequence
aacauucaacgcugucggugagu
Get sequence
Deep sequencing5130597 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).