Mature sequence mml-miR-181a-3p

Accession numberMIMAT0002622
IDmml-miR-181a-3p
Previous IDsmml-miR-213;mml-miR-181a*
Stem-Loop mml-mir-181a-1
Sequence
accaucgaccguugauuguacc
Get sequence
Deep sequencing42936 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).