Mature sequence lca-miR-92

Accession numberMIMAT0002671
IDlca-miR-92
Stem-Loop lca-mir-92-1 lca-mir-92-2
Sequence
uauugcacuugucccggccugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).