Mature sequence hsa-miR-490-3p

Accession numberMIMAT0002806
IDhsa-miR-490-3p
Previous IDshsa-miR-490
Stem-Loop hsa-mir-490
Sequence
caaccuggaggacuccaugcug
Get sequence
Deep sequencing981 reads, 48 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).