Mature sequence hsa-miR-517b-3p

Accession numberMIMAT0002857
IDhsa-miR-517b-3p
Previous IDshsa-miR-517b
Stem-Loop hsa-mir-517b
Sequence
aucgugcaucccuuuagagugu
Get sequence
Deep sequencing477 reads, 70 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).