Mature sequence fru-miR-92

Accession numberMIMAT0002924
IDfru-miR-92
Stem-Loop fru-mir-92-2 fru-mir-92-1
Sequence
uauugcacuugucccggccugu
Get sequence
Deep sequencing reads, experiments

References