Mature sequence tni-let-7i

Accession numberMIMAT0002978
IDtni-let-7i
Stem-Loop tni-let-7i
Sequence
ugagguaguaguuugugcuguu
Get sequence
Deep sequencing reads, experiments

References