Mature sequence fru-let-7g

Accession numberMIMAT0003097
IDfru-let-7g
Stem-Loop fru-let-7g
Sequence
ugagguaguaguuuguauaguu
Get sequence
Deep sequencing reads, experiments

References