Mature sequence hsa-miR-599

Accession numberMIMAT0003267
IDhsa-miR-599
Stem-Loop hsa-mir-599
Sequence
guugugucaguuuaucaaac
Get sequence
Deep sequencing11 reads, 6 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).