Mature sequence hsa-miR-600

Accession numberMIMAT0003268
IDhsa-miR-600
Stem-Loop hsa-mir-600
Sequence
acuuacagacaagagccuugcuc
Get sequence
Deep sequencing29 reads, 18 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).