Mature sequence hsa-miR-606

Accession numberMIMAT0003274
IDhsa-miR-606
Stem-Loop hsa-mir-606
Sequence
aaacuacugaaaaucaaagau
Get sequence
Deep sequencing3 reads, 2 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).