Mature sequence hsa-miR-609

Accession numberMIMAT0003277
IDhsa-miR-609
Stem-Loop hsa-mir-609
Sequence
aggguguuucucucaucucu
Get sequence
Deep sequencing52 reads, 29 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).