Mature sequence dre-miR-34b

Accession numberMIMAT0003346
IDdre-miR-34b
Stem-Loop dre-mir-34b
Sequence
uaggcaguguuguuagcugauug
Get sequence
Deep sequencing222 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).