Mature sequence gga-miR-489-3p

Accession numberMIMAT0003365
IDgga-miR-489-3p
Stem-Loop gga-mir-489
Sequence
agugacaucauauguacggcugc
Get sequence
Deep sequencing2952 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).