Mature sequence gga-miR-449a

Accession numberMIMAT0003372
IDgga-miR-449a
Previous IDsgga-miR-449
Stem-Loop gga-mir-449a
Sequence
uggcaguguauguuagcuggu
Get sequence
Deep sequencing86 reads, 3 experiments
Predicted targets

References