Mature sequence rno-miR-664-3p

Accession numberMIMAT0003382
IDrno-miR-664-3p
Previous IDsrno-miR-664
Stem-Loop rno-mir-664-1 rno-mir-664-2
Sequence
uauucauuuacuccccagccua
Get sequence
Deep sequencing77272 reads, 473 experiments
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).