Mature sequence dre-miR-18b-3p

Accession numberMIMAT0003397
IDdre-miR-18b-3p
Previous IDsdre-miR-18b*
Stem-Loop dre-mir-18b
Sequence
cugcccuaagugccccuucugg
Get sequence
Deep sequencing66 reads, 9 experiments

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).