Accession | MIMAT0003453 |
Description | mmu-miR-497a-5p mature miRNA |
Hairpins | |
Sequence | CAGCAGCACACUGUGGUUUGUA |
Evidence |
experimental
MPSS [1], cloned [2], Illumina [3,5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21305018 | has_input UniProtKB:P54320 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21305018 | has_input UniProtKB:P54320 |
involved_in | GO:0045930 negative regulation of mitotic cell cycle |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:21778430 | occurs_in CL:0000746 |