Accession | MIMAT0003502 |
Description | mmu-miR-712-5p mature miRNA |
Hairpins | |
Sequence | CUCCUUCACCCGGGCGGUACC |
Evidence |
experimental
MPSS [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24812324 | has_input UniProtKB:Q9Z0J1 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24812324 | has_input UniProtKB:Q9Z0J1 |
involved_in | GO:1903847 regulation of aorta morphogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24812324 | |
involved_in | GO:1904685 positive regulation of metalloendopeptidase activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24812324 | occurs_in CL:0002544 |
involved_in | GO:1904685 positive regulation of metalloendopeptidase activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24812324 | occurs_in UBERON:0001516 |
involved_in | GO:1904999 positive regulation of leukocyte adhesion to arterial endothelial cell |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24812324 | occurs_in CL:0002544 |