Mature sequence bta-miR-18b

Accession numberMIMAT0003517
IDbta-miR-18b
Stem-Loop bta-mir-18b
Sequence
uaaggugcaucuagugcaguua
Get sequence
Deep sequencing3877 reads, 67 experiments
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).