Mature sequence bta-miR-16b

• Accession number: MIMAT0003525
• ID: bta-miR-16b
• Previous IDs: bta-miR-16
• Stem-Loop: bta-mir-16b
• Sequence: uagcagcacguaaauauuggc
• Deep sequencing: 183034 reads, 76 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-16b

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3. PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).