Mature sequence bta-miR-16b

Accession numberMIMAT0003525
IDbta-miR-16b
Previous IDsbta-miR-16
Stem-Loop bta-mir-16b
Sequence
uagcagcacguaaauauuggc
Get sequence
Deep sequencing183034 reads, 76 experiments
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
3