Mature sequence xtr-let-7b

Accession numberMIMAT0003550
IDxtr-let-7b
Sequence
ugagguaguaguuuguguaguu
Get sequence
Stem-Loop xtr-let-7b

References