Mature sequence xtr-miR-1a

Accession numberMIMAT0003551
IDxtr-miR-1a
Sequence
uggaauguaaagaaguaugua
Get sequence
Stem-Loop xtr-mir-1a-2 xtr-mir-1a-1

References

1