Mature sequence xtr-miR-1a

Accession numberMIMAT0003551
IDxtr-miR-1a
Stem-Loop xtr-mir-1a-2 xtr-mir-1a-1
Sequence
uggaauguaaagaaguaugua
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1