Mature sequence xtr-miR-7

Accession numberMIMAT0003552
IDxtr-miR-7
Sequence
uggaagacuagugauuuuguug
Get sequence
Stem-Loop xtr-mir-7-1 xtr-mir-7-3 xtr-mir-7-2

References

1