Mature sequence xtr-miR-9a-5p

Accession numberMIMAT0003553
IDxtr-miR-9a-5p
Previous IDsxtr-miR-9a
Sequence
ucuuugguuaucuagcuguauga
Get sequence
Stem-Loop xtr-mir-9a-1 xtr-mir-9a-2

References

1