Mature sequence xtr-miR-9b-5p

Accession numberMIMAT0003555
IDxtr-miR-9b-5p
Previous IDsxtr-miR-9b
Stem-Loop xtr-mir-9b
Sequence
ucuuugguuaccuagcuguauga
Get sequence
Deep sequencing reads, experiments
Predicted targets

References