Mature sequence xtr-miR-9b-3p

Accession numberMIMAT0003556
IDxtr-miR-9b-3p
Previous IDsxtr-miR-9b*
Stem-Loop xtr-mir-9b
Sequence
uaaagcuagacaaccgaacgu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References