Mature sequence xtr-miR-9b-3p

Accession numberMIMAT0003556
IDxtr-miR-9b-3p
Previous IDsxtr-miR-9b*
Sequence
uaaagcuagacaaccgaacgu
Get sequence
Stem-Loop xtr-mir-9b

References