Mature sequence xtr-miR-10a

Accession numberMIMAT0003557
IDxtr-miR-10a
Sequence
uacccuguagauccgaauuugug
Get sequence
Stem-Loop xtr-mir-10a

References