Mature sequence xtr-miR-10b

Accession numberMIMAT0003558
IDxtr-miR-10b
Sequence
uacccuguagaaccgaauuugu
Get sequence
Stem-Loop xtr-mir-10b

References