Mature sequence xtr-miR-10c

Accession numberMIMAT0003559
IDxtr-miR-10c
Sequence
cacccuguagaaucgaauuugu
Get sequence
Stem-Loop xtr-mir-10c

References