Mature sequence xtr-miR-15a

Accession numberMIMAT0003560
IDxtr-miR-15a
Stem-Loop xtr-mir-15a
Sequence
uagcagcacauaaugguuugug
Get sequence
Deep sequencing reads, experiments
Predicted targets

References