Mature sequence xtr-miR-15b

Accession numberMIMAT0003561
IDxtr-miR-15b
Sequence
uagcagcacaucaugauuugca
Get sequence
Stem-Loop xtr-mir-15b

References

1