Mature sequence xtr-miR-16c

Accession numberMIMAT0003562
IDxtr-miR-16c
Sequence
uagcagcacguaaauacuggag
Get sequence
Stem-Loop xtr-mir-16c

References