Mature sequence xtr-miR-16a

Accession numberMIMAT0003563
IDxtr-miR-16a
Sequence
uagcagcacguaaauauuggug
Get sequence
Stem-Loop xtr-mir-16a

References

1