Mature sequence xtr-miR-17-5p

Accession numberMIMAT0003564
IDxtr-miR-17-5p
Sequence
caaagugcuuacagugcagguagu
Get sequence
Stem-Loop xtr-mir-17

References

1