Mature sequence xtr-miR-17-5p

Accession numberMIMAT0003564
IDxtr-miR-17-5p
Stem-Loop xtr-mir-17
Sequence
caaagugcuuacagugcagguagu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1