Mature sequence xtr-miR-17-3p

Accession numberMIMAT0003565
IDxtr-miR-17-3p
Sequence
acugcagugaaggcacuugu
Get sequence
Stem-Loop xtr-mir-17

References

1