Mature sequence xtr-miR-17-3p

Accession numberMIMAT0003565
IDxtr-miR-17-3p
Stem-Loop xtr-mir-17
Sequence
acugcagugaaggcacuugu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1