Mature sequence xtr-miR-19a

Accession numberMIMAT0003566
IDxtr-miR-19a
Stem-Loop xtr-mir-19a
Sequence
ugugcaaaucuaugcaaaacuga
Get sequence
Deep sequencing reads, experiments
Predicted targets

References