Mature sequence xtr-miR-19a

Accession numberMIMAT0003566
IDxtr-miR-19a
Sequence
ugugcaaaucuaugcaaaacuga
Get sequence
Stem-Loop xtr-mir-19a

References