Mature sequence xtr-miR-19b

Accession numberMIMAT0003567
IDxtr-miR-19b
Sequence
ugugcaaauccaugcaaaacuga
Get sequence
Stem-Loop xtr-mir-19b-2 xtr-mir-19b-1

References