Mature sequence xtr-miR-19b

Accession numberMIMAT0003567
IDxtr-miR-19b
Stem-Loop xtr-mir-19b-2 xtr-mir-19b-1
Sequence
ugugcaaauccaugcaaaacuga
Get sequence
Deep sequencing reads, experiments
Predicted targets

References