Mature sequence xtr-miR-23a

Accession numberMIMAT0003568
IDxtr-miR-23a
Stem-Loop xtr-mir-23a-2 xtr-mir-23a-1
Sequence
aucacauugccagggauuucc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References