Mature sequence xtr-miR-23a

Accession numberMIMAT0003568
IDxtr-miR-23a
Sequence
aucacauugccagggauuucc
Get sequence
Stem-Loop xtr-mir-23a-2 xtr-mir-23a-1

References