Mature sequence xtr-miR-26

Accession numberMIMAT0003569
IDxtr-miR-26
Sequence
uucaaguaauccaggauaggc
Get sequence
Stem-Loop xtr-mir-26-1 xtr-mir-26-2

References