Mature sequence xtr-miR-27a

Accession numberMIMAT0003570
IDxtr-miR-27a
Sequence
uucacaguggcuaaguuccgc
Get sequence
Stem-Loop xtr-mir-27a

References