Mature sequence xtr-miR-27b

Accession numberMIMAT0003571
IDxtr-miR-27b
Sequence
uucacaguggcuaaguucugc
Get sequence
Stem-Loop xtr-mir-27b

References