Mature sequence xtr-miR-29d

Accession numberMIMAT0003572
IDxtr-miR-29d
Stem-Loop xtr-mir-29d
Sequence
uagcaccauaugaaaucaguguc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References