Mature sequence xtr-miR-29b

Accession numberMIMAT0003573
IDxtr-miR-29b
Sequence
uagcaccauuugaaaucaguguu
Get sequence
Stem-Loop xtr-mir-29b

References