Mature sequence xtr-miR-98

Accession numberMIMAT0003581
IDxtr-miR-98
Stem-Loop xtr-mir-98
Sequence
ugagguaguaaguuguauuguu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1