Mature sequence xtr-miR-99

Accession numberMIMAT0003582
IDxtr-miR-99
Stem-Loop xtr-mir-99
Sequence
aacccguagauccgaucuugug
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1