Mature sequence xtr-miR-99

Accession numberMIMAT0003582
IDxtr-miR-99
Sequence
aacccguagauccgaucuugug
Get sequence
Stem-Loop xtr-mir-99

References

1