Mature sequence xtr-miR-122

Accession numberMIMAT0003585
IDxtr-miR-122
Stem-Loop xtr-mir-122
Sequence
uggagugugacaaugguguuugu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1