Mature sequence xtr-miR-122

Accession numberMIMAT0003585
IDxtr-miR-122
Sequence
uggagugugacaaugguguuugu
Get sequence
Stem-Loop xtr-mir-122

References

1