Mature sequence xtr-miR-128

Accession numberMIMAT0003589
IDxtr-miR-128
Stem-Loop xtr-mir-128-2 xtr-mir-128-1
Sequence
ucacagugaaccggucucuuuu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1