Mature sequence xtr-miR-142-5p

Accession numberMIMAT0003602
IDxtr-miR-142-5p
Stem-Loop xtr-mir-142-1 xtr-mir-142-2
Sequence
cauaaaguagaaagcacuac
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1